Transcript: Mouse XM_006501008.2

PREDICTED: Mus musculus guanine nucleotide binding protein, alpha transducing 2 (Gnat2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gnat2 (14686)
Length:
1837
CDS:
144..1208

Additional Resources:

NCBI RefSeq record:
XM_006501008.2
NBCI Gene record:
Gnat2 (14686)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000097958 GCCGGGAATTATATCAAGAGT pLKO.1 1038 CDS 100% 3.000 4.200 N Gnat2 n/a
2 TRCN0000316549 GCCGGGAATTATATCAAGAGT pLKO_005 1038 CDS 100% 3.000 4.200 N Gnat2 n/a
3 TRCN0000304887 ATGCTCAGTTCCTCGAATATA pLKO_005 1208 CDS 100% 15.000 10.500 N Gnat2 n/a
4 TRCN0000418774 AGGGAGTCACCTGCATCATTT pLKO_005 790 CDS 100% 13.200 9.240 N GNAT2 n/a
5 TRCN0000304828 CCACACTAGGCATTGACTATG pLKO_005 409 CDS 100% 10.800 7.560 N Gnat2 n/a
6 TRCN0000097956 GCACGAGTCTTTGCATCTGTT pLKO.1 872 CDS 100% 4.950 3.465 N Gnat2 n/a
7 TRCN0000097955 GCTTAGAATCTGAGGCTTCAT pLKO.1 1243 3UTR 100% 4.950 3.465 N Gnat2 n/a
8 TRCN0000316548 GCTTAGAATCTGAGGCTTCAT pLKO_005 1243 3UTR 100% 4.950 3.465 N Gnat2 n/a
9 TRCN0000097959 AGACCCTAACTACCTCCCTAA pLKO.1 632 CDS 100% 4.050 2.835 N Gnat2 n/a
10 TRCN0000097643 CAAGACTGTCAAGCTGCTGTT pLKO.1 236 CDS 100% 4.050 2.835 N LOC239863 n/a
11 TRCN0000097957 CTCGGCATCTTACTACCTGAA pLKO.1 593 CDS 100% 4.050 2.835 N Gnat2 n/a
12 TRCN0000349105 CTCGGCATCTTACTACCTGAA pLKO_005 593 CDS 100% 4.050 2.835 N Gnat2 n/a
13 TRCN0000097639 CCTAGAGTTCAAGTCTGTCAT pLKO.1 341 CDS 100% 4.950 2.970 N LOC239863 n/a
14 TRCN0000097640 CGTCAAACAGATGAAGATCAT pLKO.1 290 CDS 100% 4.950 2.970 N LOC239863 n/a
15 TRCN0000187053 CAAGTCTGTCATCTATGGGAA pLKO.1 350 CDS 100% 2.640 1.584 N LOC239863 n/a
16 TRCN0000097642 CACTATCGTCAAACAGATGAA pLKO.1 284 CDS 100% 4.950 2.475 Y LOC239863 n/a
17 TRCN0000184969 CACTATCGTCAAACAGATGAA pLKO.1 284 CDS 100% 4.950 2.475 Y LOC239863 n/a
18 TRCN0000008801 GCATCTTACTACCTGAACCAA pLKO.1 597 CDS 100% 3.000 2.100 N GNAT2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501008.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06293 pDONR223 100% 89.6% 95.7% None (many diffs) n/a
2 ccsbBroad304_06293 pLX_304 0% 89.6% 95.7% V5 (many diffs) n/a
3 TRCN0000468862 CTTGGGTGATAGCCACCTCACTGC pLX_317 45.1% 89.6% 95.7% V5 (many diffs) n/a
4 TRCN0000488518 CCGCGTGCTCGGTTGCTAATGCTA pLX_317 32.2% 89.6% 95.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV