Transcript: Mouse XM_006501021.3

PREDICTED: Mus musculus glutathione S-transferase, mu 4 (Gstm4), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Gstm4 (14865)
Length:
1531
CDS:
149..703

Additional Resources:

NCBI RefSeq record:
XM_006501021.3
NBCI Gene record:
Gstm4 (14865)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103336 CGGACATGGTTTGTTGGTGAA pLKO.1 479 CDS 100% 4.050 5.670 N Gstm4 n/a
2 TRCN0000302882 CGGACATGGTTTGTTGGTGAA pLKO_005 479 CDS 100% 4.050 5.670 N Gstm4 n/a
3 TRCN0000103337 GAAGAGGATCTCTGCTTACAT pLKO.1 619 CDS 100% 5.625 3.938 N Gstm4 n/a
4 TRCN0000302967 GAAGAGGATCTCTGCTTACAT pLKO_005 619 CDS 100% 5.625 3.938 N Gstm4 n/a
5 TRCN0000103335 GCTGTGCTGTTGTGAAGAGTT pLKO.1 945 3UTR 100% 4.950 3.465 N Gstm4 n/a
6 TRCN0000302883 GCTGTGCTGTTGTGAAGAGTT pLKO_005 945 3UTR 100% 4.950 3.465 N Gstm4 n/a
7 TRCN0000103339 CCCTGGAATGGTGAAGCTCTT pLKO.1 439 CDS 100% 4.050 2.835 N Gstm4 n/a
8 TRCN0000103338 AGAGAAGATTCGCGTGGACAT pLKO.1 322 CDS 100% 4.050 2.430 N Gstm4 n/a
9 TRCN0000302884 AGAGAAGATTCGCGTGGACAT pLKO_005 322 CDS 100% 4.050 2.430 N Gstm4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501021.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13866 pDONR223 100% 72.4% 72% None (many diffs) n/a
2 TRCN0000465604 TAACCACCCTTTTATTTACAACGA pLX_317 59.4% 72.4% 72% V5 (many diffs) n/a
Download CSV