Transcript: Mouse XM_006501107.1

PREDICTED: Mus musculus nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105 (Nfkb1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Nfkb1 (18033)
Length:
3808
CDS:
580..3108

Additional Resources:

NCBI RefSeq record:
XM_006501107.1
NBCI Gene record:
Nfkb1 (18033)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235482 GGCTACTCGAACTACGGATTT pLKO_005 1399 CDS 100% 10.800 15.120 N Nfkb1 n/a
2 TRCN0000235484 AGTACCTTGATGCGCAATAAA pLKO_005 3541 3UTR 100% 15.000 12.000 N Nfkb1 n/a
3 TRCN0000009513 GCACCATAAACACCAAATTTA pLKO.1 1484 CDS 100% 15.000 10.500 N Nfkb1 n/a
4 TRCN0000235486 AGTATAAGGATGTCAACATTA pLKO_005 1136 CDS 100% 13.200 9.240 N Nfkb1 n/a
5 TRCN0000235485 CGGATGACAGAGGCGTGTATT pLKO_005 652 CDS 100% 13.200 9.240 N Nfkb1 n/a
6 TRCN0000235483 GGTCACCCATGGCACCATAAA pLKO_005 1473 CDS 100% 13.200 9.240 N Nfkb1 n/a
7 TRCN0000009510 GCAGGGTCACTCGATTTCATT pLKO.1 3219 3UTR 100% 5.625 3.938 N Nfkb1 n/a
8 TRCN0000009514 CACTGCTTTGACTCACTCAAT pLKO.1 223 5UTR 100% 4.950 3.465 N Nfkb1 n/a
9 TRCN0000009512 CCCACTGCTATCTCTGAACAA pLKO.1 3039 CDS 100% 4.950 3.465 N Nfkb1 n/a
10 TRCN0000009511 GCAGGTATTTGACATACTAAA pLKO.1 2526 CDS 100% 13.200 7.920 N Nfkb1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501107.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06637 pDONR223 100% 72% 74.1% None (many diffs) n/a
2 ccsbBroad304_06637 pLX_304 13.5% 63.5% 60.1% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV