Transcript: Mouse XM_006501152.2

PREDICTED: Mus musculus ATP-binding cassette, sub-family D (ALD), member 3 (Abcd3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcd3 (19299)
Length:
3481
CDS:
393..2153

Additional Resources:

NCBI RefSeq record:
XM_006501152.2
NBCI Gene record:
Abcd3 (19299)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000313757 TTCTTGAAGTATGGGTTAAAT pLKO_005 597 CDS 100% 15.000 21.000 N Abcd3 n/a
2 TRCN0000105337 CGTTCTGATTTGTGGTCCAAA pLKO.1 1577 CDS 100% 4.950 6.930 N Abcd3 n/a
3 TRCN0000105335 GCCTGAATTAAATTGGGCTTA pLKO.1 2409 3UTR 100% 4.050 5.670 N Abcd3 n/a
4 TRCN0000105336 GCCTCTTATCTCTCTGGTTAA pLKO.1 572 CDS 100% 10.800 8.640 N Abcd3 n/a
5 TRCN0000349994 CCATTTGAAGTCAGCTAATTT pLKO_005 2464 3UTR 100% 15.000 10.500 N Abcd3 n/a
6 TRCN0000105339 CTCTTATCTCTCTGGTTAATA pLKO.1 574 CDS 100% 15.000 10.500 N Abcd3 n/a
7 TRCN0000317345 CTCTTATCTCTCTGGTTAATA pLKO_005 574 CDS 100% 15.000 10.500 N Abcd3 n/a
8 TRCN0000349995 TCCAAGCTTTCACCTATTATA pLKO_005 673 CDS 100% 15.000 10.500 N Abcd3 n/a
9 TRCN0000313758 ACTGGTGGAACACCTACATAA pLKO_005 1067 CDS 100% 13.200 9.240 N Abcd3 n/a
10 TRCN0000105338 CCATTGGTAAGATGACAATTA pLKO.1 922 CDS 100% 13.200 9.240 N Abcd3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501152.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15556 pDONR223 0% 22.6% 22.9% None (many diffs) n/a
2 ccsbBroad304_15556 pLX_304 0% 22.6% 22.9% V5 (many diffs) n/a
3 TRCN0000470789 AGCCACCCTCGGCCAACCTCGCGA pLX_317 66% 22.6% 22.9% V5 (many diffs) n/a
Download CSV