Transcript: Mouse XM_006501163.2

PREDICTED: Mus musculus RAR-related orphan receptor gamma (Rorc), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rorc (19885)
Length:
1856
CDS:
175..1206

Additional Resources:

NCBI RefSeq record:
XM_006501163.2
NBCI Gene record:
Rorc (19885)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000222410 CACCTTGAGTATAGTCCAGAA pLKO.1 769 CDS 100% 4.050 5.670 N Rorc n/a
2 TRCN0000222407 CGGAGCAGACACACTTACATA pLKO.1 594 CDS 100% 5.625 3.938 N Rorc n/a
3 TRCN0000033655 CACCTCACAAATTGAAGTGAT pLKO.1 240 CDS 100% 4.950 3.465 N RORC n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501163.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01411 pDONR223 100% 57.5% 51.8% None (many diffs) n/a
2 ccsbBroad304_01411 pLX_304 0% 57.5% 51.8% V5 (many diffs) n/a
3 TRCN0000469419 ACTAGTTAAGAATCGAAGCCCGTT pLX_317 27.8% 57.5% 51.8% V5 (many diffs) n/a
4 TRCN0000488170 AAGGTGCCAACGACCAACTGTTTA pLX_317 21.6% 57.5% 51.8% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV