Transcript: Mouse XM_006501173.3

PREDICTED: Mus musculus S100 calcium binding protein A3 (S100a3), transcript variant X4, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
S100a3 (20197)
Length:
2283
CDS:
1627..1932

Additional Resources:

NCBI RefSeq record:
XM_006501173.3
NBCI Gene record:
S100a3 (20197)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000178381 GATAAATACAAGATCTGCCAG pLKO.1 1699 CDS 100% 2.160 3.024 N S100a3 n/a
2 TRCN0000248295 CGGGAGTGTGACTACAATAAA pLKO_005 1777 CDS 100% 15.000 12.000 N S100a3 n/a
3 TRCN0000248293 GATCCAAAGGTGTACGCTATC pLKO_005 1938 3UTR 100% 6.000 4.800 N S100a3 n/a
4 TRCN0000248294 ACTGCCACGAGTACTTCAAAG pLKO_005 1880 CDS 100% 10.800 7.560 N S100a3 n/a
5 TRCN0000248292 GTGTTCTGGATACCAACAAAG pLKO_005 1805 CDS 100% 10.800 7.560 N S100a3 n/a
6 TRCN0000248291 TGTGCACCTTCCAGGAGTATG pLKO_005 1664 CDS 100% 10.800 7.560 N S100a3 n/a
7 TRCN0000217184 CCAAGTTCTTGATGTGCTAAC pLKO.1 2070 3UTR 100% 6.000 4.200 N S100a3 n/a
8 TRCN0000198586 GATACCAACAAAGACTGCGAA pLKO.1 1813 CDS 100% 2.640 1.848 N S100a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501173.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01473 pDONR223 100% 90% 90% None (many diffs) n/a
2 ccsbBroad304_01473 pLX_304 0% 90% 90% V5 (many diffs) n/a
3 TRCN0000473783 CATCTAGTGGATACGACGGGCAAC pLX_317 100% 90% 90% V5 (many diffs) n/a
Download CSV