Transcript: Mouse XM_006501177.3

PREDICTED: Mus musculus S100 calcium binding protein A4 (S100a4), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
S100a4 (20198)
Length:
560
CDS:
114..419

Additional Resources:

NCBI RefSeq record:
XM_006501177.3
NBCI Gene record:
S100a4 (20198)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000011860 TGTGTCCACCTTCCACAAATA pLKO.1 149 CDS 100% 13.200 9.240 N S100a4 n/a
2 TRCN0000344975 TGTGTCCACCTTCCACAAATA pLKO_005 149 CDS 100% 13.200 9.240 N S100a4 n/a
3 TRCN0000011862 CAGGGACAATGAAGTTGACTT pLKO.1 308 CDS 100% 4.950 3.465 N S100a4 n/a
4 TRCN0000345049 CAGGGACAATGAAGTTGACTT pLKO_005 308 CDS 100% 4.950 3.465 N S100a4 n/a
5 TRCN0000011858 CCAGAAGGTGATGAGCAACTT pLKO.1 278 CDS 100% 4.950 3.465 N S100a4 n/a
6 TRCN0000437516 GAGCAACTTGGACAGCAACAG pLKO_005 290 CDS 100% 4.050 2.835 N S100A4 n/a
7 TRCN0000011859 GATGAGCAACTTGGACAGCAA pLKO.1 287 CDS 100% 2.640 1.848 N S100a4 n/a
8 TRCN0000344976 GATGAGCAACTTGGACAGCAA pLKO_005 287 CDS 100% 2.640 1.848 N S100a4 n/a
9 TRCN0000011861 CATGATGTGCAATGAATTCTT pLKO.1 362 CDS 100% 0.000 0.000 N S100a4 n/a
10 TRCN0000344977 CATGATGTGCAATGAATTCTT pLKO_005 362 CDS 100% 0.000 0.000 N S100a4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501177.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01474 pDONR223 100% 89.8% 93% None (many diffs) n/a
2 TRCN0000466183 TGACACACAATCGTTTTGTGCCAA pLX_317 100% 89.8% 93% V5 (many diffs) n/a
Download CSV