Transcript: Mouse XM_006501212.3

PREDICTED: Mus musculus src homology 2 domain-containing transforming protein C1 (Shc1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Shc1 (20416)
Length:
3123
CDS:
312..1553

Additional Resources:

NCBI RefSeq record:
XM_006501212.3
NBCI Gene record:
Shc1 (20416)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055179 GCCATCAGTTTGGTGTGTGAA pLKO.1 384 CDS 100% 4.950 6.930 N Shc1 n/a
2 TRCN0000301522 GCCATCAGTTTGGTGTGTGAA pLKO_005 384 CDS 100% 4.950 6.930 N Shc1 n/a
3 TRCN0000088011 GCAGCTCAATGGTGACTTCTT pLKO.1 1307 CDS 100% 4.950 3.960 N Gm5500 n/a
4 TRCN0000308024 TCAGCTACCACATGGACAATC pLKO_005 1468 CDS 100% 10.800 7.560 N SHC1 n/a
5 TRCN0000055181 CCTGACCATCAGTACTACAAT pLKO.1 846 CDS 100% 5.625 3.938 N Shc1 n/a
6 TRCN0000301525 CCTGACCATCAGTACTACAAT pLKO_005 846 CDS 100% 5.625 3.938 N Shc1 n/a
7 TRCN0000055178 GCCGACTGCAAACAGATCATT pLKO.1 549 CDS 100% 5.625 3.938 N Shc1 n/a
8 TRCN0000301526 GCCGACTGCAAACAGATCATT pLKO_005 549 CDS 100% 5.625 3.938 N Shc1 n/a
9 TRCN0000055180 GCTGAGTATGTTGCCTATGTT pLKO.1 624 CDS 100% 5.625 3.938 N Shc1 n/a
10 TRCN0000301591 GCTGAGTATGTTGCCTATGTT pLKO_005 624 CDS 100% 5.625 3.938 N Shc1 n/a
11 TRCN0000088012 GTTGCCAAAGACCCTGTGAAT pLKO.1 642 CDS 100% 4.950 3.465 N Gm5500 n/a
12 TRCN0000055182 CGGACAAAGGATCACCGCTTT pLKO.1 1428 CDS 100% 4.050 2.835 N Shc1 n/a
13 TRCN0000301521 CGGACAAAGGATCACCGCTTT pLKO_005 1428 CDS 100% 4.050 2.835 N Shc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501212.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01531 pDONR223 100% 78.3% 83.3% None (many diffs) n/a
2 ccsbBroad304_01531 pLX_304 0% 78.3% 83.3% V5 (many diffs) n/a
3 TRCN0000465390 ATCGGCAAGCCATCCCTGGATCAC pLX_317 28.1% 78.3% 83.3% V5 (many diffs) n/a
4 TRCN0000491918 GCGGCCTCTAACTACATTGATACC pLX_317 21% 73.4% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV