Transcript: Mouse XM_006501224.3

PREDICTED: Mus musculus sortilin 1 (Sort1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sort1 (20661)
Length:
6838
CDS:
88..2562

Additional Resources:

NCBI RefSeq record:
XM_006501224.3
NBCI Gene record:
Sort1 (20661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034496 CCGTCCTATCAATGTGATTAA pLKO.1 1701 CDS 100% 13.200 18.480 N Sort1 n/a
2 TRCN0000301697 CCGTCCTATCAATGTGATTAA pLKO_005 1701 CDS 100% 13.200 18.480 N Sort1 n/a
3 TRCN0000034497 GCACCTGACAACAAATGGGTA pLKO.1 2202 CDS 100% 2.640 2.112 N Sort1 n/a
4 TRCN0000301699 GCACCTGACAACAAATGGGTA pLKO_005 2202 CDS 100% 2.640 2.112 N Sort1 n/a
5 TRCN0000034494 GCAGCCTTCATATCCATGCTT pLKO.1 1451 CDS 100% 3.000 2.100 N Sort1 n/a
6 TRCN0000301700 GCAGCCTTCATATCCATGCTT pLKO_005 1451 CDS 100% 3.000 2.100 N Sort1 n/a
7 TRCN0000034498 CCAAGTCAAATTCTGTCCCTA pLKO.1 2333 CDS 100% 2.640 1.848 N Sort1 n/a
8 TRCN0000034495 GCCTCTGGTAATTGTGAGCTT pLKO.1 477 CDS 100% 2.640 1.848 N Sort1 n/a
9 TRCN0000301621 GCCTCTGGTAATTGTGAGCTT pLKO_005 477 CDS 100% 2.640 1.848 N Sort1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501224.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000489425 CTGATGTACAGCTGTTCTTTAACA pLX_317 15.2% 86.9% 90.6% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000491874 ACCCATCGGATGTATAGAGGGTCC pLX_317 13% 86.9% 90.5% V5 (many diffs) n/a
Download CSV