Transcript: Mouse XM_006501280.3

PREDICTED: Mus musculus T-box 15 (Tbx15), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tbx15 (21384)
Length:
3369
CDS:
242..1732

Additional Resources:

NCBI RefSeq record:
XM_006501280.3
NBCI Gene record:
Tbx15 (21384)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000084360 CGCGTCTCAAAGCACTTTACT pLKO.1 1531 CDS 100% 5.625 7.875 N Tbx15 n/a
2 TRCN0000334007 CGCGTCTCAAAGCACTTTACT pLKO_005 1531 CDS 100% 5.625 7.875 N Tbx15 n/a
3 TRCN0000084361 GTAATCTAAACCTCTCTGATT pLKO.1 1098 CDS 100% 4.950 6.930 N Tbx15 n/a
4 TRCN0000333929 GTAATCTAAACCTCTCTGATT pLKO_005 1098 CDS 100% 4.950 6.930 N Tbx15 n/a
5 TRCN0000084362 CCACATCAGCAATACTATATA pLKO.1 386 CDS 100% 15.000 10.500 N Tbx15 n/a
6 TRCN0000334005 CCACATCAGCAATACTATATA pLKO_005 386 CDS 100% 15.000 10.500 N Tbx15 n/a
7 TRCN0000084359 CGCAAAGACTTTAGCAGTGAT pLKO.1 665 CDS 100% 4.950 3.465 N Tbx15 n/a
8 TRCN0000333928 CGCAAAGACTTTAGCAGTGAT pLKO_005 665 CDS 100% 4.950 3.465 N Tbx15 n/a
9 TRCN0000084358 ACAACAATAGATACCGCTGAA pLKO.1 1890 3UTR 100% 4.050 2.835 N Tbx15 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2079 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501280.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07035 pDONR223 100% 92.9% 98.9% None (many diffs) n/a
2 TRCN0000468373 TTTGGCTTTTTCACCGCCTACTGA pLX_317 26.9% 92.9% 98.9% V5 (many diffs) n/a
Download CSV