Transcript: Mouse XM_006501425.3

PREDICTED: Mus musculus solute carrier family 35 (UDP-N-acetylglucosamine (UDP-GlcNAc) transporter), member 3 (Slc35a3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc35a3 (229782)
Length:
5650
CDS:
475..1491

Additional Resources:

NCBI RefSeq record:
XM_006501425.3
NBCI Gene record:
Slc35a3 (229782)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000079759 CGACCTCCTTATCCATAATAT pLKO.1 1331 CDS 100% 15.000 21.000 N Slc35a3 n/a
2 TRCN0000325784 CGACCTCCTTATCCATAATAT pLKO_005 1331 CDS 100% 15.000 21.000 N Slc35a3 n/a
3 TRCN0000306044 TCAAGCTACATGATCTATTTA pLKO_005 1887 3UTR 100% 15.000 21.000 N Slc35a3 n/a
4 TRCN0000306045 TAATGGGTGTATACGTTTATG pLKO_005 1172 CDS 100% 13.200 18.480 N Slc35a3 n/a
5 TRCN0000079761 GATGCGGTATTCTAGGACTTT pLKO.1 579 CDS 100% 4.950 3.960 N Slc35a3 n/a
6 TRCN0000079760 GCGGTATTCTAGGACTTTAAA pLKO.1 582 CDS 100% 15.000 10.500 N Slc35a3 n/a
7 TRCN0000325785 GCGGTATTCTAGGACTTTAAA pLKO_005 582 CDS 100% 15.000 10.500 N Slc35a3 n/a
8 TRCN0000079758 CCCTACAGAAATATAGACAAA pLKO.1 3683 3UTR 100% 4.950 3.465 N Slc35a3 n/a
9 TRCN0000079762 CTTCAGAACAACTTACTCTAT pLKO.1 796 CDS 100% 4.950 3.465 N Slc35a3 n/a
10 TRCN0000325786 CTTCAGAACAACTTACTCTAT pLKO_005 796 CDS 100% 4.950 3.465 N Slc35a3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501425.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11735 pDONR223 100% 55.9% 59.7% None (many diffs) n/a
2 ccsbBroad304_11735 pLX_304 0% 55.9% 59.7% V5 (many diffs) n/a
3 TRCN0000469720 GAAGGATTTCGGTCTGCAATATCG pLX_317 61.9% 55.9% 59.7% V5 (many diffs) n/a
Download CSV