Transcript: Mouse XM_006501449.2

PREDICTED: Mus musculus heparan sulfate 2-O-sulfotransferase 1 (Hs2st1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Hs2st1 (23908)
Length:
4198
CDS:
297..1370

Additional Resources:

NCBI RefSeq record:
XM_006501449.2
NBCI Gene record:
Hs2st1 (23908)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000103127 GCTAGTTTCCTACTATTACTT pLKO.1 803 CDS 100% 5.625 7.875 N Hs2st1 n/a
2 TRCN0000312372 GCTAGTTTCCTACTATTACTT pLKO_005 803 CDS 100% 5.625 7.875 N Hs2st1 n/a
3 TRCN0000103128 GCTAAGTCTAACCTCATTAAT pLKO.1 1014 CDS 100% 15.000 12.000 N Hs2st1 n/a
4 TRCN0000349442 GCTAAGTCTAACCTCATTAAT pLKO_005 1014 CDS 100% 15.000 12.000 N Hs2st1 n/a
5 TRCN0000313414 GTGAAGAAGAAACCAATTTAT pLKO_005 753 CDS 100% 15.000 10.500 N Hs2st1 n/a
6 TRCN0000313485 TCAGATGGCTGAATACCATTT pLKO_005 1657 3UTR 100% 10.800 7.560 N Hs2st1 n/a
7 TRCN0000103129 GAGACGGAAACAAGGAGACAA pLKO.1 860 CDS 100% 4.950 3.465 N Hs2st1 n/a
8 TRCN0000312373 GAGACGGAAACAAGGAGACAA pLKO_005 860 CDS 100% 4.950 3.465 N Hs2st1 n/a
9 TRCN0000103126 GCAGTCTGACATTTGGAAGAT pLKO.1 1214 CDS 100% 4.950 3.465 N Hs2st1 n/a
10 TRCN0000103125 GCCCATATTTATGTAGGCTTT pLKO.1 1892 3UTR 100% 4.050 2.835 N Hs2st1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501449.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02221 pDONR223 100% 58.3% 62.1% None (many diffs) n/a
2 ccsbBroad304_02221 pLX_304 0% 58.3% 62.1% V5 (many diffs) n/a
3 TRCN0000474800 AGGAAACTTGTAGACTTAGAAACG pLX_317 72.2% 58.3% 62.1% V5 (many diffs) n/a
Download CSV