Transcript: Mouse XM_006501645.3

PREDICTED: Mus musculus mastermind like 3 (Drosophila) (Maml3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Maml3 (433586)
Length:
6882
CDS:
944..4348

Additional Resources:

NCBI RefSeq record:
XM_006501645.3
NBCI Gene record:
Maml3 (433586)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243591 GATAGGACCTGCCGGTTTATA pLKO_005 5406 3UTR 100% 15.000 21.000 N Maml3 n/a
2 TRCN0000243590 GCCGCGAATGGTAGTAGTATC pLKO_005 971 CDS 100% 10.800 15.120 N Maml3 n/a
3 TRCN0000243592 TGCGAGCATCGAGGTTGATTG pLKO_005 3399 CDS 100% 10.800 15.120 N Maml3 n/a
4 TRCN0000193361 CGTAAATTGAGAACATGACAT pLKO.1 4440 3UTR 100% 4.950 3.960 N Maml3 n/a
5 TRCN0000243593 TTGGGTACAAACTCCTTAAAC pLKO_005 2660 CDS 100% 13.200 9.240 N Maml3 n/a
6 TRCN0000243594 AGATAGCAGGTGGCAACTTTG pLKO_005 4137 CDS 100% 10.800 7.560 N Maml3 n/a
7 TRCN0000063893 GCCAAATAACTTGGGTACAAA pLKO.1 2650 CDS 100% 5.625 3.938 N MAML3 n/a
8 TRCN0000173522 GAAGACGACCATGAACAACTA pLKO.1 2593 CDS 100% 4.950 3.465 N Maml3 n/a
9 TRCN0000063896 CCCAAGCCTTTAACAACCAAA pLKO.1 2538 CDS 100% 4.950 2.475 Y MAML3 n/a
10 TRCN0000166364 CACACACACACACACACACAA pLKO.1 5843 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501645.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000481450 TCCCCATCCTGAACCATTGGTTAA pLX_317 13.3% 84.8% 87.2% V5 (many diffs) n/a
2 ccsbBroadEn_14200 pDONR223 100% 84.8% 81.2% None (many diffs) n/a
3 ccsbBroad304_14200 pLX_304 0% 84.8% 81.2% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV