Transcript: Mouse XM_006501810.1

PREDICTED: Mus musculus suppressor of Ty 20 (Supt20), transcript variant X10, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Supt20 (56790)
Length:
3158
CDS:
288..2876

Additional Resources:

NCBI RefSeq record:
XM_006501810.1
NBCI Gene record:
Supt20 (56790)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000257389 TAGTGGAAGAAAGTCTATATT pLKO_005 377 CDS 100% 15.000 21.000 N Supt20 n/a
2 TRCN0000225966 GCCAATAGGCTGCTCTATAAC pLKO_005 942 CDS 100% 13.200 18.480 N Supt20 n/a
3 TRCN0000225967 TGACGCAGAGAGGGTAGTTAA pLKO_005 1487 CDS 100% 13.200 18.480 N Supt20 n/a
4 TRCN0000081524 GCAGAAGAATTACCTCCTATT pLKO.1 636 CDS 100% 10.800 8.640 N Supt20 n/a
5 TRCN0000081526 CAGAAGAATTACCTCCTATTT pLKO.1 637 CDS 100% 13.200 9.240 N Supt20 n/a
6 TRCN0000081525 CCATTCAAACTGGTTTGTCAT pLKO.1 1454 CDS 100% 4.950 3.465 N Supt20 n/a
7 TRCN0000081527 GCAGGAGACTTTGTCGTGTTT pLKO.1 494 CDS 100% 4.950 3.465 N Supt20 n/a
8 TRCN0000219055 ATAGTTCCTCAGGTAACTATT pLKO_005 1696 CDS 100% 1.320 0.792 N Supt20 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501810.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08547 pDONR223 100% 78.3% 79.7% None (many diffs) n/a
2 ccsbBroad304_08547 pLX_304 0% 78.3% 79.7% V5 (many diffs) n/a
3 TRCN0000469326 GGACCCTGATTTTGCTTCTAACCA pLX_317 16.2% 78.3% 79.7% V5 (many diffs) n/a
Download CSV