Transcript: Mouse XM_006501828.3

PREDICTED: Mus musculus myozenin 2 (Myoz2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Myoz2 (59006)
Length:
1219
CDS:
335..1042

Additional Resources:

NCBI RefSeq record:
XM_006501828.3
NBCI Gene record:
Myoz2 (59006)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000098478 GCGGGATTACAGGAGCTTTAA pLKO.1 784 CDS 100% 13.200 18.480 N Myoz2 n/a
2 TRCN0000098477 GATAGAAGAATTGTCCCATTT pLKO.1 376 CDS 100% 10.800 15.120 N Myoz2 n/a
3 TRCN0000098479 TGCGGGATTACAGGAGCTTTA pLKO.1 783 CDS 100% 10.800 7.560 N Myoz2 n/a
4 TRCN0000098476 CTGACAAATACACCTTTGAAA pLKO.1 441 CDS 100% 5.625 3.938 N Myoz2 n/a
5 TRCN0000098475 CCACAGGAAGTTCTGCACATA pLKO.1 1060 3UTR 100% 4.950 3.465 N Myoz2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501828.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03383 pDONR223 100% 77.5% 79.9% None (many diffs) n/a
2 ccsbBroad304_03383 pLX_304 0% 77.5% 79.9% V5 (many diffs) n/a
3 TRCN0000491345 TACATGACAATGTCCTTATCGTGT pLX_317 35% 77.5% 79.9% V5 (many diffs) n/a
4 ccsbBroadEn_15857 pDONR223 0% 77.3% 79.9% None (many diffs) n/a
5 ccsbBroad304_15857 pLX_304 0% 77.3% 79.9% V5 (many diffs) n/a
6 TRCN0000480033 GAATAAAAGGAACACGTGTTTGCG pLX_317 45.4% 77.3% 79.9% V5 (many diffs) n/a
Download CSV