Transcript: Mouse XM_006501934.2

PREDICTED: Mus musculus solute carrier family 39 (metal ion transporter), member 8 (Slc39a8), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Slc39a8 (67547)
Length:
3080
CDS:
254..1642

Additional Resources:

NCBI RefSeq record:
XM_006501934.2
NBCI Gene record:
Slc39a8 (67547)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006501934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000336081 ATTTCGTGGGACTCGCTATTG pLKO_005 744 CDS 100% 10.800 15.120 N Slc39a8 n/a
2 TRCN0000336020 TACGCAGGAGACATCGAATTG pLKO_005 1616 CDS 100% 10.800 15.120 N Slc39a8 n/a
3 TRCN0000336019 TGGGACTAGCTTTCGGCATTT pLKO_005 1392 CDS 100% 10.800 15.120 N Slc39a8 n/a
4 TRCN0000079555 CCAAACTGTCAGAAATAGGAA pLKO.1 1143 CDS 100% 3.000 2.400 N Slc39a8 n/a
5 TRCN0000353366 CAACGCGGGAAGGCATTTAAT pLKO_005 1663 3UTR 100% 15.000 10.500 N Slc39a8 n/a
6 TRCN0000079556 CCAGAGGCATTTGGATTTAAT pLKO.1 800 CDS 100% 15.000 10.500 N Slc39a8 n/a
7 TRCN0000079553 GCCAAGTTATCTCAGGAATTA pLKO.1 2915 3UTR 100% 13.200 9.240 N Slc39a8 n/a
8 TRCN0000353367 GTAGCCGGAAGTGGAGTATAA pLKO_005 1639 CDS 100% 13.200 9.240 N Slc39a8 n/a
9 TRCN0000043689 GCTGCACTTCAACCAGTGTTT pLKO.1 457 CDS 100% 4.950 3.465 N SLC39A8 n/a
10 TRCN0000310564 GCTGCACTTCAACCAGTGTTT pLKO_005 457 CDS 100% 4.950 3.465 N SLC39A8 n/a
11 TRCN0000079557 TCTACATTTCTCTGGCAGATA pLKO.1 1470 CDS 100% 4.950 3.465 N Slc39a8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006501934.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03926 pDONR223 100% 83.8% 88.9% None (many diffs) n/a
2 ccsbBroad304_03926 pLX_304 0% 83.8% 88.9% V5 (many diffs) n/a
3 TRCN0000479659 GGATCTGAGCGCCTTTTTGGCCTC pLX_317 26.6% 83.8% 88.9% V5 (many diffs) n/a
Download CSV