Transcript: Mouse XM_006502009.3

PREDICTED: Mus musculus progestin and adipoQ receptor family member VI (Paqr6), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Paqr6 (68957)
Length:
1965
CDS:
236..1387

Additional Resources:

NCBI RefSeq record:
XM_006502009.3
NBCI Gene record:
Paqr6 (68957)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000126708 TGCTCGTCACATCTGCTACTT pLKO.1 607 CDS 100% 4.950 3.465 N Paqr6 n/a
2 TRCN0000126706 GATGACTAATGAGACGGTCAA pLKO.1 412 CDS 100% 4.050 2.835 N Paqr6 n/a
3 TRCN0000126707 CCTGGGCGCTTCGACTATATT pLKO.1 1091 CDS 100% 15.000 7.500 Y Paqr6 n/a
4 TRCN0000126705 GCAGTGATTGGGAACCTGTTT pLKO.1 1265 CDS 100% 4.950 2.475 Y Paqr6 n/a
5 TRCN0000126704 GCGACTATTCTGACCCTGAAA pLKO.1 1468 3UTR 100% 4.950 2.475 Y Paqr6 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502009.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04151 pDONR223 100% 74.9% 78.1% None (many diffs) n/a
2 ccsbBroad304_04151 pLX_304 0% 74.9% 78.1% V5 (many diffs) n/a
3 TRCN0000475775 TGTCACAGTGGTTACAGCCTGAAA pLX_317 30.1% 74.9% 78.1% V5 (many diffs) n/a
Download CSV