Transcript: Mouse XM_006502468.3

PREDICTED: Mus musculus Sec24 related gene family, member B (S. cerevisiae) (Sec24b), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Sec24b (99683)
Length:
5043
CDS:
151..3915

Additional Resources:

NCBI RefSeq record:
XM_006502468.3
NBCI Gene record:
Sec24b (99683)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000348303 GCGAACAGCCACCCAACTAAT pLKO_005 883 CDS 100% 13.200 18.480 N Sec24b n/a
2 TRCN0000380066 GGTACTCGCTTGTATGAATTA pLKO_005 4272 3UTR 100% 13.200 18.480 N Sec24b n/a
3 TRCN0000100593 GCTCCGTAGTATCCACAGTTT pLKO.1 932 CDS 100% 4.950 6.930 N Sec24b n/a
4 TRCN0000100594 CAACCTGTGTTATAGAGTTAA pLKO.1 1986 CDS 100% 13.200 10.560 N Sec24b n/a
5 TRCN0000348236 ATGAAAGCAAAGAGCTTATAA pLKO_005 2396 CDS 100% 15.000 10.500 N Sec24b n/a
6 TRCN0000380660 CATTTCCCTGTAAGGACAATA pLKO_005 4334 3UTR 100% 13.200 9.240 N Sec24b n/a
7 TRCN0000100590 GCTGTAACTAAGAAGATGAAT pLKO.1 4427 3UTR 100% 5.625 3.938 N Sec24b n/a
8 TRCN0000100591 GCATATTCTACTATCCATCTT pLKO.1 2768 CDS 100% 4.950 3.465 N Sec24b n/a
9 TRCN0000334222 GCATATTCTACTATCCATCTT pLKO_005 2768 CDS 100% 4.950 3.465 N Sec24b n/a
10 TRCN0000100592 CCCGGATCTTTCCAAGGAATT pLKO.1 391 CDS 100% 0.000 0.000 N Sec24b n/a
11 TRCN0000334298 CCCGGATCTTTCCAAGGAATT pLKO_005 391 CDS 100% 0.000 0.000 N Sec24b n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502468.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.