Transcript: Mouse XM_006502978.4

PREDICTED: Mus musculus terminal uridylyl transferase 4 (Tut4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Tut4 (230594)
Length:
5865
CDS:
286..5235

Additional Resources:

NCBI RefSeq record:
XM_006502978.4
NBCI Gene record:
Tut4 (230594)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006502978.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000241806 GCCACGCTTTCGAGGACTAAA pLKO_005 5013 CDS 100% 13.200 18.480 N Tut4 n/a
2 TRCN0000241804 ACACGTTTAGATAGCTTATTT pLKO_005 5365 3UTR 100% 15.000 10.500 N Tut4 n/a
3 TRCN0000423930 ACACGTTTAGATAGCTTATTT pLKO_005 5365 3UTR 100% 15.000 10.500 N TUT4 n/a
4 TRCN0000241805 CAGAGCAGCTTATCGATATTT pLKO_005 2445 CDS 100% 15.000 10.500 N Tut4 n/a
5 TRCN0000241802 GACAAACCGATTTCGAGAAAT pLKO_005 3165 CDS 100% 13.200 9.240 N Tut4 n/a
6 TRCN0000241803 GGGCTAAGCTGTGCTATATTG pLKO_005 1853 CDS 100% 13.200 9.240 N Tut4 n/a
7 TRCN0000435890 ATTAGCTGTATTCATACTTTG pLKO_005 5580 3UTR 100% 10.800 7.560 N TUT4 n/a
8 TRCN0000147949 GCTACTTATGCAGCTATTGAT pLKO.1 3592 CDS 100% 5.625 3.938 N TUT4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006502978.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07867 pDONR223 100% 87% 86.5% None (many diffs) n/a
2 ccsbBroad304_07867 pLX_304 0% 87% 86.5% V5 (many diffs) n/a
3 TRCN0000469078 ATAGACGTCGAATAATTACGACAT pLX_317 6.3% 87% 86.5% V5 (many diffs) n/a
Download CSV