Transcript: Mouse XM_006503019.1

PREDICTED: Mus musculus zinc metallopeptidase, STE24 (Zmpste24), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zmpste24 (230709)
Length:
3494
CDS:
251..1735

Additional Resources:

NCBI RefSeq record:
XM_006503019.1
NBCI Gene record:
Zmpste24 (230709)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000377120 TTACCTACGTGTTGTTATAAT pLKO_005 2154 3UTR 100% 15.000 21.000 N Zmpste24 n/a
2 TRCN0000366713 ACCATTTATGCTGACTATATT pLKO_005 944 CDS 100% 15.000 10.500 N Zmpste24 n/a
3 TRCN0000366640 ACAGTCCTGAGCCGCAGATTT pLKO_005 1529 CDS 100% 13.200 9.240 N Zmpste24 n/a
4 TRCN0000031078 CGATTGTATCAACTGGATAAA pLKO.1 452 CDS 100% 13.200 9.240 N Zmpste24 n/a
5 TRCN0000366641 CTGGATGCTCTTCCGGTTATT pLKO_005 1754 3UTR 100% 13.200 9.240 N Zmpste24 n/a
6 TRCN0000377056 GACCAGAATACGAGATCATTC pLKO_005 651 CDS 100% 10.800 7.560 N Zmpste24 n/a
7 TRCN0000377055 TATGTTGTTGAAGGATCTAAG pLKO_005 1064 CDS 100% 10.800 7.560 N Zmpste24 n/a
8 TRCN0000031077 CCGGTTTCTGACTGGTTGTTT pLKO.1 1643 CDS 100% 5.625 3.938 N Zmpste24 n/a
9 TRCN0000031076 GCGGCAGAGAAGGATATACAA pLKO.1 367 CDS 100% 5.625 3.938 N Zmpste24 n/a
10 TRCN0000031075 CCAAGAAACTTGGGAAGGCTA pLKO.1 1572 CDS 100% 2.640 1.848 N Zmpste24 n/a
11 TRCN0000031074 GCCTGGCTGTTCACATTAGTT pLKO.1 905 CDS 100% 5.625 3.375 N Zmpste24 n/a
12 TRCN0000306941 CAGCGGCAGAGAAGGATATAT pLKO_005 365 CDS 100% 15.000 10.500 N ZMPSTE24 n/a
13 TRCN0000050430 CACCTTACAATGAGGTTCTTT pLKO.1 1497 CDS 100% 5.625 3.938 N ZMPSTE24 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503019.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14041 pDONR223 100% 86.3% 89.2% None (many diffs) n/a
2 ccsbBroad304_14041 pLX_304 0% 86.3% 89.2% V5 (not translated due to frame shift) (many diffs) n/a
Download CSV