Transcript: Mouse XM_006503071.3

PREDICTED: Mus musculus autophagy related 4C, cysteine peptidase (Atg4c), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Atg4c (242557)
Length:
7896
CDS:
5355..6671

Additional Resources:

NCBI RefSeq record:
XM_006503071.3
NBCI Gene record:
Atg4c (242557)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000030946 CGGCAAACCTAAACAGTCATA pLKO.1 6266 CDS 100% 4.950 6.930 N Atg4c n/a
2 TRCN0000030947 GCCATTCCAAAGACTTTGATT pLKO.1 6556 CDS 100% 5.625 3.938 N Atg4c n/a
3 TRCN0000030948 GAAATATAGTTGGGTGTTGAA pLKO.1 5423 CDS 100% 4.950 3.465 N Atg4c n/a
4 TRCN0000030944 CCTTGAATACTGTGTAGGTAT pLKO.1 6239 CDS 100% 4.950 2.970 N Atg4c n/a
5 TRCN0000086233 CCTTCCTTTCTTTCTTTCTTT pLKO.1 7293 3UTR 100% 5.625 2.813 Y Pou1f1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503071.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04451 pDONR223 100% 84.6% 86.8% None (many diffs) n/a
2 ccsbBroad304_04451 pLX_304 0% 84.6% 86.8% V5 (many diffs) n/a
3 TRCN0000467723 CTCGGAATCATCGAAAGATTCCTT pLX_317 27.7% 84.6% 86.8% V5 (many diffs) n/a
Download CSV