Transcript: Mouse XM_006503101.1

PREDICTED: Mus musculus regulating synaptic membrane exocytosis 3 (Rims3), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Rims3 (242662)
Length:
6546
CDS:
550..1473

Additional Resources:

NCBI RefSeq record:
XM_006503101.1
NBCI Gene record:
Rims3 (242662)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000243913 GCTCCGAGGGCACGTTTATTT pLKO_005 896 CDS 100% 15.000 21.000 N Rims3 n/a
2 TRCN0000243912 CACCGGCTGGTACAAACTCTT pLKO_005 1356 CDS 100% 4.950 6.930 N Rims3 n/a
3 TRCN0000413114 ATCCCTCCCAGCCACCTATAT pLKO_005 1110 CDS 100% 13.200 9.240 N RIMS3 n/a
4 TRCN0000243914 GGTGCCAAGATGGTAGCTATC pLKO_005 697 CDS 100% 6.000 4.200 N Rims3 n/a
5 TRCN0000243910 CCTCCCAGCCACCTATATCAA pLKO_005 1113 CDS 100% 5.625 3.938 N Rims3 n/a
6 TRCN0000243911 ATGGGTATGGCCCAGATCATG pLKO_005 1306 CDS 100% 4.950 3.465 N Rims3 n/a
7 TRCN0000176145 GAAAGCCAGTTCAGTGACTTT pLKO.1 937 CDS 100% 4.950 3.465 N Rims3 n/a
8 TRCN0000175546 CCAGGAATGTAGTAAGGAGTT pLKO.1 590 CDS 100% 4.050 2.835 N Rims3 n/a
9 TRCN0000194349 CACCAAGAAGCTTCGAAGCAA pLKO.1 774 CDS 100% 3.000 2.100 N Rims3 n/a
10 TRCN0000063705 AGGTGGAAGTGATTGAAGCTC pLKO.1 1061 CDS 100% 2.640 1.584 N RIMS3 n/a
11 TRCN0000063704 GAGGTGGAAGTGATTGAAGCT pLKO.1 1060 CDS 100% 2.640 1.584 N RIMS3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503101.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14029 pDONR223 100% 89.9% 95.8% None (many diffs) n/a
2 ccsbBroad304_14029 pLX_304 0% 89.9% 95.8% V5 (many diffs) n/a
3 TRCN0000474577 CACCTTTATCTCTCCGTTTTCGGT pLX_317 34.1% 89.9% 95.8% V5 (many diffs) n/a
Download CSV