Transcript: Mouse XM_006503323.3

PREDICTED: Mus musculus BEN domain containing 5 (Bend5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Bend5 (67621)
Length:
2675
CDS:
1382..2284

Additional Resources:

NCBI RefSeq record:
XM_006503323.3
NBCI Gene record:
Bend5 (67621)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000176296 CCCAAACTTTCTCTCAGTCAT pLKO.1 1658 CDS 100% 4.950 3.465 N Bend5 n/a
2 TRCN0000173161 CGAAACTACCAGCAGCAACAA pLKO.1 1943 CDS 100% 4.950 3.465 N Bend5 n/a
3 TRCN0000193952 GAACAGTGTGATGCAGAAGAA pLKO.1 1627 CDS 100% 4.950 3.465 N Bend5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503323.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08942 pDONR223 100% 66.8% 70% None (many diffs) n/a
2 ccsbBroad304_08942 pLX_304 0% 66.8% 70% V5 (many diffs) n/a
3 TRCN0000470324 CTAGTTCACTCCTCAGTACGAGAT pLX_317 28.7% 66.8% 70% V5 (many diffs) n/a
4 ccsbBroadEn_14265 pDONR223 100% 29.1% 30.8% None (many diffs) n/a
5 ccsbBroad304_14265 pLX_304 0% 29.1% 30.8% V5 (many diffs) n/a
6 TRCN0000467530 TAATTGTAGAAGAGTACATATTTA pLX_317 54.1% 29.1% 30.8% V5 (many diffs) n/a
Download CSV