Transcript: Mouse XM_006503570.1

PREDICTED: Mus musculus RIKEN cDNA 9330182L06 gene (9330182L06Rik), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
9330182L06Rik (231014)
Length:
5679
CDS:
360..3107

Additional Resources:

NCBI RefSeq record:
XM_006503570.1
NBCI Gene record:
9330182L06Rik (231014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000127441 CCAGGCACTTTCAGCAACAAA pLKO.1 900 CDS 100% 5.625 7.875 N 9330182L06Rik n/a
2 TRCN0000127443 AGGTCAAGATAACAGACGATT pLKO.1 1739 CDS 100% 4.950 3.960 N 9330182L06Rik n/a
3 TRCN0000127442 CGTTAATATCAAGGAGGATAT pLKO.1 2405 CDS 100% 1.080 0.864 N 9330182L06Rik n/a
4 TRCN0000415055 GTATGCCAGTCAACTATTATT pLKO_005 2286 CDS 100% 15.000 10.500 N 9330182L06Rik n/a
5 TRCN0000415471 GAACTGGGAAGGATAACATTT pLKO_005 1542 CDS 100% 13.200 9.240 N 9330182L06Rik n/a
6 TRCN0000432569 TGCACTACCAAAGACTATTTC pLKO_005 1053 CDS 100% 13.200 9.240 N 9330182L06Rik n/a
7 TRCN0000127439 CCCAAGTTTAAGCCCACCAAT pLKO.1 3336 3UTR 100% 4.950 3.465 N 9330182L06Rik n/a
8 TRCN0000127440 CCTGCTTCAATGTTGGGAATT pLKO.1 1375 CDS 100% 0.000 0.000 N 9330182L06Rik n/a
9 TRCN0000144942 GCTCTCTGTACCAACAATATA pLKO.1 2199 CDS 100% 15.000 21.000 N KIAA1324L n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503570.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13433 pDONR223 100% 78.1% 83% None (many diffs) n/a
2 ccsbBroad304_13433 pLX_304 0% 78.1% 83% V5 (many diffs) n/a
3 TRCN0000465430 GCGACATGGAAGAGCTAACTACAT pLX_317 14.6% 78.1% 83% V5 (many diffs) n/a
Download CSV