Transcript: Mouse XM_006503574.1

PREDICTED: Mus musculus cyclin D binding myb-like transcription factor 1 (Dmtf1), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Dmtf1 (23857)
Length:
3264
CDS:
616..2103

Additional Resources:

NCBI RefSeq record:
XM_006503574.1
NBCI Gene record:
Dmtf1 (23857)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311114 TCTGAAGGCTCGCGGAATAAA pLKO_005 155 5UTR 100% 15.000 21.000 N Dmtf1 n/a
2 TRCN0000077825 CCTCGGCCTAAGATGACTATA pLKO.1 1669 CDS 100% 13.200 18.480 N Dmtf1 n/a
3 TRCN0000302034 CCTCGGCCTAAGATGACTATA pLKO_005 1669 CDS 100% 13.200 18.480 N Dmtf1 n/a
4 TRCN0000077824 CGGCCTAAGATGACTATACAA pLKO.1 1672 CDS 100% 5.625 7.875 N Dmtf1 n/a
5 TRCN0000077826 GCGATAATGTCACGGTACAAT pLKO.1 1493 CDS 100% 5.625 7.875 N Dmtf1 n/a
6 TRCN0000302033 GCGATAATGTCACGGTACAAT pLKO_005 1493 CDS 100% 5.625 7.875 N Dmtf1 n/a
7 TRCN0000077823 GCTGGTTGTAATTCAGCTTAT pLKO.1 2473 3UTR 100% 10.800 8.640 N Dmtf1 n/a
8 TRCN0000331795 GCTGGTTGTAATTCAGCTTAT pLKO_005 2473 3UTR 100% 10.800 8.640 N Dmtf1 n/a
9 TRCN0000017785 CGGCCTTTGTTTGCAGTTTAT pLKO.1 255 5UTR 100% 13.200 9.240 N DMTF1 n/a
10 TRCN0000077827 CTCACTAACAAAGGACATAAA pLKO.1 72 5UTR 100% 13.200 9.240 N Dmtf1 n/a
11 TRCN0000369352 GGCAATGACTGGGCAACAATA pLKO_005 544 5UTR 100% 13.200 9.240 N DMTF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503574.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07528 pDONR223 100% 59.4% 61.4% None (many diffs) n/a
2 ccsbBroad304_07528 pLX_304 0% 59.4% 61.4% V5 (many diffs) n/a
3 TRCN0000473726 ATCATTGGTCATGAAGGGCCATTA pLX_317 17.9% 59.4% 61.4% V5 (many diffs) n/a
Download CSV