Transcript: Mouse XM_006503680.2

PREDICTED: Mus musculus adducin 1 (alpha) (Add1), transcript variant X15, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Add1 (11518)
Length:
2160
CDS:
178..2160

Additional Resources:

NCBI RefSeq record:
XM_006503680.2
NBCI Gene record:
Add1 (11518)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108808 CCTTTGCTAGTGATGGCGATT pLKO.1 1436 CDS 100% 4.050 5.670 N Add1 n/a
2 TRCN0000302992 CCTTTGCTAGTGATGGCGATT pLKO_005 1436 CDS 100% 4.050 5.670 N Add1 n/a
3 TRCN0000108806 CCAGCTTATCTACAATCATAT pLKO.1 663 CDS 100% 13.200 10.560 N Add1 n/a
4 TRCN0000303066 CCAGCTTATCTACAATCATAT pLKO_005 663 CDS 100% 13.200 10.560 N Add1 n/a
5 TRCN0000108807 CCTGAACATGAGTCTTGGTAT pLKO.1 525 CDS 100% 4.950 3.465 N Add1 n/a
6 TRCN0000303065 CCTGAACATGAGTCTTGGTAT pLKO_005 525 CDS 100% 4.950 3.465 N Add1 n/a
7 TRCN0000108809 GCAGAAGAAGAGGGTGTCTAT pLKO.1 336 CDS 100% 4.950 3.465 N Add1 n/a
8 TRCN0000315466 GCAGAAGAAGAGGGTGTCTAT pLKO_005 336 CDS 100% 4.950 3.465 N Add1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503680.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13809 pDONR223 100% 54.2% 56.4% None (many diffs) n/a
2 ccsbBroad304_13809 pLX_304 0% 54.2% 56.4% V5 (many diffs) n/a
3 TRCN0000471276 AGATAGCTCATTCCGGATCCTATA pLX_317 34% 54.2% 56.4% V5 (many diffs) n/a
Download CSV