Transcript: Mouse XM_006503697.3

PREDICTED: Mus musculus amyloid beta (A4) precursor protein-binding, family B, member 2 (Apbb2), transcript variant X12, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Apbb2 (11787)
Length:
7202
CDS:
2753..3385

Additional Resources:

NCBI RefSeq record:
XM_006503697.3
NBCI Gene record:
Apbb2 (11787)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000328168 GCCGCCACCATGTGATATAAA pLKO_005 3542 3UTR 100% 15.000 21.000 N Apbb2 n/a
2 TRCN0000353337 TGCCACAAGTCTCCACGAAAT pLKO_005 2719 5UTR 100% 10.800 15.120 N Apbb2 n/a
3 TRCN0000328101 TGCAGTACCTGGGCATGTTAC pLKO_005 2883 CDS 100% 10.800 7.560 N Apbb2 n/a
4 TRCN0000054425 CCACGAAATCTGCTCCAAGAT pLKO.1 2731 5UTR 100% 4.950 3.465 N Apbb2 n/a
5 TRCN0000054423 GCCAACTAACACTGCATCCTT pLKO.1 3686 3UTR 100% 3.000 2.100 N Apbb2 n/a
6 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2145 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503697.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10680 pDONR223 100% 56.3% 60.3% None (many diffs) n/a
2 ccsbBroad304_10680 pLX_304 0% 56.3% 60.3% V5 (many diffs) n/a
3 TRCN0000467211 TCGACAATGATCTCATCATGGCAT pLX_317 30.8% 56.3% 60.3% V5 (many diffs) n/a
Download CSV