Transcript: Mouse XM_006503874.3

PREDICTED: Mus musculus ATP/GTP binding protein-like 5 (Agbl5), transcript variant X9, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Agbl5 (231093)
Length:
2946
CDS:
121..2823

Additional Resources:

NCBI RefSeq record:
XM_006503874.3
NBCI Gene record:
Agbl5 (231093)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000031388 CAACAGGTCATGGTTCTACTT pLKO.1 606 CDS 100% 4.950 6.930 N Agbl5 n/a
2 TRCN0000031386 GCTATCCTTTGTTCACCGTTT pLKO.1 804 CDS 100% 4.050 5.670 N Agbl5 n/a
3 TRCN0000031385 GCCAATAATCTCCACAATGAA pLKO.1 1498 CDS 100% 5.625 4.500 N Agbl5 n/a
4 TRCN0000031387 CCAAAGCTCATCTCCTTGAAT pLKO.1 1780 CDS 100% 5.625 3.938 N Agbl5 n/a
5 TRCN0000031384 CCATTCCGTTTCACAGGCAAA pLKO.1 1102 CDS 100% 4.050 2.835 N Agbl5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503874.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12427 pDONR223 100% 68% 67.2% None (many diffs) n/a
2 ccsbBroad304_12427 pLX_304 0% 68% 67.2% V5 (many diffs) n/a
3 TRCN0000478467 TCTGTTTAATGATTCCTATCTCTC pLX_317 14.5% 68% 67.2% V5 (many diffs) n/a
Download CSV