Transcript: Mouse XM_006503970.3

PREDICTED: Mus musculus zinc finger protein 512 (Zfp512), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp512 (269639)
Length:
1374
CDS:
134..1327

Additional Resources:

NCBI RefSeq record:
XM_006503970.3
NBCI Gene record:
Zfp512 (269639)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000193458 GTACTTAGAGATCATGGATAA pLKO.1 619 CDS 100% 10.800 8.640 N Zfp512 n/a
2 TRCN0000137601 CGTTCTGCCAAGATAGCTGTA pLKO.1 1160 CDS 100% 4.050 2.835 N ZNF512 n/a
3 TRCN0000285460 CGTTCTGCCAAGATAGCTGTA pLKO_005 1160 CDS 100% 4.050 2.835 N ZNF512 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503970.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12820 pDONR223 100% 47.5% 48.2% None (many diffs) n/a
2 ccsbBroad304_12820 pLX_304 0% 47.5% 48.2% V5 (many diffs) n/a
3 TRCN0000472898 ATGTCTGTTTATCCGTCTGGCGGC pLX_317 18.6% 47.5% 48.2% V5 (many diffs) n/a
Download CSV