Transcript: Mouse XM_006503978.3

PREDICTED: Mus musculus DEP domain containing 5 (Depdc5), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Depdc5 (277854)
Length:
8074
CDS:
485..5287

Additional Resources:

NCBI RefSeq record:
XM_006503978.3
NBCI Gene record:
Depdc5 (277854)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105922 CGAGGAATACAAGTGGAATTA pLKO.1 3220 CDS 100% 13.200 18.480 N Depdc5 n/a
2 TRCN0000105921 GCCATTATTCAAGCTACATAA pLKO.1 1615 CDS 100% 13.200 18.480 N Depdc5 n/a
3 TRCN0000105920 CGCCAACCAAATCTTGCCAAT pLKO.1 5461 3UTR 100% 4.050 3.240 N Depdc5 n/a
4 TRCN0000105923 CCCTAAAGTATTTCCTCACAT pLKO.1 562 CDS 100% 4.950 3.465 N Depdc5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503978.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02226 pDONR223 100% 32.1% 33.6% None (many diffs) n/a
2 ccsbBroad304_02226 pLX_304 0% 32.1% 33.6% V5 (many diffs) n/a
3 TRCN0000471584 ACGCCCCGTCACTGCACAAAGTGG pLX_317 23.1% 32.1% 33.6% V5 (many diffs) n/a
Download CSV