Transcript: Mouse XM_006503992.2

PREDICTED: Mus musculus DNA segment, Chr 5, ERATO Doi 579, expressed (D5Ertd579e), transcript variant X6, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
D5Ertd579e (320661)
Length:
6610
CDS:
392..4651

Additional Resources:

NCBI RefSeq record:
XM_006503992.2
NBCI Gene record:
D5Ertd579e (320661)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006503992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000347229 ACTTCTATGAAGTGGATATTG pLKO_005 1920 CDS 100% 13.200 10.560 N D5Ertd579e n/a
2 TRCN0000347236 TACTTTCATTGATGGTCATTT pLKO_005 1786 CDS 100% 13.200 10.560 N D5Ertd579e n/a
3 TRCN0000254774 TGCAGATTCTAGTGCTAATAT pLKO_005 2416 CDS 100% 15.000 10.500 N D5Ertd579e n/a
4 TRCN0000134944 GCAGAATGTTGCATAGTGTTA pLKO.1 2042 CDS 100% 4.950 3.465 N KIAA0232 n/a
5 TRCN0000277623 GCAGAATGTTGCATAGTGTTA pLKO_005 2042 CDS 100% 4.950 3.465 N KIAA0232 n/a
6 TRCN0000347303 TGTGAGGCCTGTTAGTCTAAA pLKO_005 4705 3UTR 100% 13.200 7.920 N D5Ertd579e n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006503992.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07483 pDONR223 100% 86.7% 86.8% None (many diffs) n/a
2 ccsbBroad304_07483 pLX_304 0% 86.7% 86.8% V5 (many diffs) n/a
3 TRCN0000479299 ATATGACTAGACACAAACCTCCTA pLX_317 9.8% 86.7% 86.8% V5 (many diffs) n/a
Download CSV