Transcript: Mouse XM_006504098.2

PREDICTED: Mus musculus actin filament associated protein 1 (Afap1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Afap1 (70292)
Length:
6886
CDS:
226..2688

Additional Resources:

NCBI RefSeq record:
XM_006504098.2
NBCI Gene record:
Afap1 (70292)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000105847 GCAGTACAAATATGGGAAGAA pLKO.1 2148 CDS 100% 4.950 6.930 N Afap1 n/a
2 TRCN0000415075 ACCAAGCTGCTGTGCTATAAA pLKO_005 757 CDS 100% 15.000 10.500 N Afap1 n/a
3 TRCN0000105846 CCAGAGTACATCACCTCAAAT pLKO.1 538 CDS 100% 13.200 9.240 N Afap1 n/a
4 TRCN0000425713 GTGTCCAAATTTACTTGTTAA pLKO_005 2877 3UTR 100% 13.200 9.240 N Afap1 n/a
5 TRCN0000105848 GCAGTGGTTGAAGGTAATCAA pLKO.1 936 CDS 100% 5.625 3.938 N Afap1 n/a
6 TRCN0000105849 CCAGAGGGTTACTATGAGGAA pLKO.1 490 CDS 100% 2.640 1.848 N Afap1 n/a
7 TRCN0000105845 CCCAGAGACTGTGTACTGCCA pLKO.1 2705 3UTR 100% 0.220 0.154 N Afap1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504098.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08789 pDONR223 100% 75.3% 81.4% None (many diffs) n/a
2 ccsbBroad304_08789 pLX_304 0% 75.3% 81.4% V5 (many diffs) n/a
3 TRCN0000469880 TCAGTTATAAATAGTTGCAGCACG pLX_317 19.8% 75.3% 81.4% V5 (many diffs) n/a
Download CSV