Transcript: Mouse XM_006504264.3

PREDICTED: Mus musculus FIP1 like 1 (S. cerevisiae) (Fip1l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fip1l1 (66899)
Length:
4943
CDS:
325..2139

Additional Resources:

NCBI RefSeq record:
XM_006504264.3
NBCI Gene record:
Fip1l1 (66899)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000311354 ACCAAGCAGTGGGACTATTAT pLKO_005 1690 CDS 100% 15.000 21.000 N Fip1l1 n/a
2 TRCN0000305533 TAGTAACTAAGTGGACTATTT pLKO_005 2628 3UTR 100% 13.200 18.480 N Fip1l1 n/a
3 TRCN0000123574 GCCCATAATATACTCTGTCTT pLKO.1 3101 3UTR 100% 4.950 6.930 N Fip1l1 n/a
4 TRCN0000123575 CCACTGAAGTAGACAACAATT pLKO.1 1358 CDS 100% 13.200 9.240 N Fip1l1 n/a
5 TRCN0000332095 CCACTGAAGTAGACAACAATT pLKO_005 1358 CDS 100% 13.200 9.240 N Fip1l1 n/a
6 TRCN0000123578 CCATCTCTTATACCAACAATA pLKO.1 1552 CDS 100% 13.200 9.240 N Fip1l1 n/a
7 TRCN0000123577 CGTCGCCATGAAAGTGAAGAA pLKO.1 2002 CDS 100% 4.950 3.465 N Fip1l1 n/a
8 TRCN0000332096 CGTCGCCATGAAAGTGAAGAA pLKO_005 2002 CDS 100% 4.950 3.465 N Fip1l1 n/a
9 TRCN0000123576 CGTGCAAATGAGAACAGCAAT pLKO.1 1312 CDS 100% 4.950 3.465 N Fip1l1 n/a
10 TRCN0000332028 CGTGCAAATGAGAACAGCAAT pLKO_005 1312 CDS 100% 4.950 3.465 N Fip1l1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504264.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_16010 pDONR223 0% 78.1% 82.2% None (many diffs) n/a
2 ccsbBroad304_16010 pLX_304 0% 78.1% 82.2% V5 (many diffs) n/a
Download CSV