Transcript: Mouse XM_006504673.3

PREDICTED: Mus musculus sorting nexin 8 (Snx8), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Snx8 (231834)
Length:
1571
CDS:
16..1317

Additional Resources:

NCBI RefSeq record:
XM_006504673.3
NBCI Gene record:
Snx8 (231834)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000379727 AGCCGGGAGCTGATTCGAAAT pLKO_005 583 CDS 100% 10.800 15.120 N Snx8 n/a
2 TRCN0000381765 GAGAACGTGATCCAGACTATG pLKO_005 1057 CDS 100% 10.800 15.120 N Snx8 n/a
3 TRCN0000105941 CCAGACTATGGAACTCCGAAA pLKO.1 1068 CDS 100% 4.050 5.670 N Snx8 n/a
4 TRCN0000105942 GCTGCTGATCTTCTCATATTT pLKO.1 670 CDS 100% 15.000 12.000 N Snx8 n/a
5 TRCN0000381749 ACGCTGCTGATCTTCTCATAT pLKO_005 668 CDS 100% 13.200 9.240 N Snx8 n/a
6 TRCN0000105944 GCTGACATCCAGACTCAATTT pLKO.1 556 CDS 100% 13.200 9.240 N Snx8 n/a
7 TRCN0000105943 GATTTGTTGCAGTCCTACAAA pLKO.1 886 CDS 100% 0.563 0.394 N Snx8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504673.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08130 pDONR223 100% 77% 76.2% None (many diffs) n/a
2 ccsbBroad304_08130 pLX_304 0% 77% 76.2% V5 (many diffs) n/a
3 TRCN0000475084 TGCTTGTGAGTACACCCCTGTATA pLX_317 20.5% 77% 76.2% V5 (many diffs) n/a
Download CSV