Transcript: Mouse XM_006504890.3

PREDICTED: Mus musculus microtubule associated tumor suppressor candidate 2 (Mtus2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Mtus2 (77521)
Length:
5165
CDS:
428..4489

Additional Resources:

NCBI RefSeq record:
XM_006504890.3
NBCI Gene record:
Mtus2 (77521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006504890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000265091 AGCTCGGAAATTCGAATTTAA pLKO_005 603 CDS 100% 15.000 21.000 N Mtus2 n/a
2 TRCN0000216736 GAGCTCGGAAATTCGAATTTA pLKO.1 602 CDS 100% 15.000 21.000 N Mtus2 n/a
3 TRCN0000265094 GGTACTAGACTCACCGGTAAA pLKO_005 1610 CDS 100% 10.800 15.120 N Mtus2 n/a
4 TRCN0000179628 GAACCAACGAAGAACTACTTT pLKO.1 4350 CDS 100% 5.625 7.875 N Mtus2 n/a
5 TRCN0000265092 AGATACAAATGCCAATCAAAT pLKO_005 526 CDS 100% 13.200 9.240 N Mtus2 n/a
6 TRCN0000196174 GCCAACATCAGGGATGAAGTT pLKO.1 3542 CDS 100% 4.950 3.465 N Mtus2 n/a
7 TRCN0000265093 TAGCTGCACAATGCATCTTAG pLKO_005 4604 3UTR 100% 10.800 6.480 N Mtus2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006504890.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02744 pDONR223 100% 21.7% 22.5% None (many diffs) n/a
2 ccsbBroad304_02744 pLX_304 0% 21.7% 22.5% V5 (many diffs) n/a
3 TRCN0000474380 TAGAGCGGAGGTTATATGCCAATG pLX_317 45% 21.7% 22.5% V5 (many diffs) n/a
Download CSV