Transcript: Mouse XM_006505102.3

PREDICTED: Mus musculus family with sequence similarity 3, member C (Fam3c), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Fam3c (27999)
Length:
2872
CDS:
260..943

Additional Resources:

NCBI RefSeq record:
XM_006505102.3
NBCI Gene record:
Fam3c (27999)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000216399 GAAGTAATAGACACCAAATTT pLKO.1 602 CDS 100% 15.000 21.000 N Fam3c n/a
2 TRCN0000115959 GATGCAAGTTTAGGAAATCTA pLKO.1 353 CDS 100% 5.625 4.500 N FAM3C n/a
3 TRCN0000191797 GATGCAAGTTTAGGAAATCTA pLKO.1 353 CDS 100% 5.625 4.500 N Fam3c n/a
4 TRCN0000292666 GATGCAAGTTTAGGAAATCTA pLKO_005 353 CDS 100% 5.625 4.500 N Fam3c n/a
5 TRCN0000292668 CTGTCGATTCCAGGATTATTT pLKO_005 1068 3UTR 100% 15.000 10.500 N Fam3c n/a
6 TRCN0000292741 CAGTCTTGGTTTCCGAGATAA pLKO_005 781 CDS 100% 13.200 9.240 N Fam3c n/a
7 TRCN0000191316 CCACTTCAAATGCAACATAAA pLKO.1 1979 3UTR 100% 13.200 9.240 N Fam3c n/a
8 TRCN0000191798 GAACAGCACATAAAGAACAAT pLKO.1 848 CDS 100% 5.625 3.938 N Fam3c n/a
9 TRCN0000292737 GAACAGCACATAAAGAACAAT pLKO_005 848 CDS 100% 5.625 3.938 N Fam3c n/a
10 TRCN0000191770 GTATTCTTACTGACCTTCTAT pLKO.1 302 CDS 100% 5.625 3.938 N Fam3c n/a
11 TRCN0000292739 GTATTCTTACTGACCTTCTAT pLKO_005 302 CDS 100% 5.625 3.938 N Fam3c n/a
12 TRCN0000200657 CAATAAGGAAACGAACAAGTA pLKO.1 865 CDS 100% 4.950 3.465 N Fam3c n/a
13 TRCN0000192657 GTACAAGTGTGGGATCTCAAA pLKO.1 424 CDS 100% 4.950 3.465 N Fam3c n/a
14 TRCN0000192832 GTGGCACCATTCATTGAGTTT pLKO.1 644 CDS 100% 4.950 3.465 N Fam3c n/a
15 TRCN0000190261 CGCTACTGTTTCTCTCCTCAA pLKO.1 2159 3UTR 100% 4.050 2.835 N Fam3c n/a
16 TRCN0000298584 GAGGAGATGTGGCACCATTTA pLKO_005 636 CDS 100% 13.200 9.240 N FAM3C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505102.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02438 pDONR223 100% 88.2% 94.2% None (many diffs) n/a
2 ccsbBroad304_02438 pLX_304 0% 88.2% 94.2% V5 (many diffs) n/a
3 TRCN0000472626 TGTCGGAAGTACAACGGTAACAGG pLX_317 71% 88.2% 94.2% V5 (many diffs) n/a
Download CSV