Transcript: Mouse XM_006505122.1

PREDICTED: Mus musculus paraoxonase 2 (Pon2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pon2 (330260)
Length:
1883
CDS:
376..1182

Additional Resources:

NCBI RefSeq record:
XM_006505122.1
NBCI Gene record:
Pon2 (330260)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055028 GCGACCATATATGATAGGAAA pLKO.1 1114 CDS 100% 4.950 3.960 N Pon2 n/a
2 TRCN0000055032 CTGGTGGACAATTTATCTATT pLKO.1 913 CDS 100% 13.200 9.240 N Pon2 n/a
3 TRCN0000055031 GCTGAGGACATTGACATTCTT pLKO.1 271 5UTR 100% 5.625 3.938 N Pon2 n/a
4 TRCN0000055029 CGACTTAAAGCCTCCAGAGAA pLKO.1 102 5UTR 100% 4.950 3.465 N Pon2 n/a
5 TRCN0000055030 CTTGAAGTATTTGGAGACATA pLKO.1 684 CDS 100% 4.950 3.465 N Pon2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505122.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11045 pDONR223 100% 32.7% 32.2% None (many diffs) n/a
2 ccsbBroad304_11045 pLX_304 0% 32.7% 32.2% V5 (many diffs) n/a
3 TRCN0000467502 AGCTTCCAACACCTCCGAGACAGT pLX_317 71.3% 32.7% 32.2% V5 (many diffs) n/a
Download CSV