Transcript: Mouse XM_006505145.2

PREDICTED: Mus musculus zinc finger protein 800 (Zfp800), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp800 (627049)
Length:
7264
CDS:
182..2329

Additional Resources:

NCBI RefSeq record:
XM_006505145.2
NBCI Gene record:
Zfp800 (627049)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255250 GTCGGAAACGTGATGTGATAA pLKO_005 1761 CDS 100% 13.200 18.480 N Zfp800 n/a
2 TRCN0000427081 AGACATCCAAATCTGGTATTC pLKO_005 291 CDS 100% 10.800 15.120 N ZNF800 n/a
3 TRCN0000415201 TTTAGAGATCAGAGCTATAAA pLKO_005 1840 CDS 100% 15.000 10.500 N ZNF800 n/a
4 TRCN0000255248 ATCTCCTAGAAGCCATATATC pLKO_005 525 CDS 100% 13.200 9.240 N Zfp800 n/a
5 TRCN0000255247 GGACTAAGGAGGGATTCAATT pLKO_005 1118 CDS 100% 13.200 9.240 N Zfp800 n/a
6 TRCN0000267550 GGCCGAAGTACAAGATCTAAG pLKO_005 2138 CDS 100% 10.800 7.560 N Zfp800 n/a
7 TRCN0000021158 GCTGGCTTTGACTTTAAGCAA pLKO.1 1610 CDS 100% 3.000 2.100 N ZNF800 n/a
8 TRCN0000166364 CACACACACACACACACACAA pLKO.1 6593 3UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505145.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05146 pDONR223 100% 85.8% 87.3% None (many diffs) n/a
2 ccsbBroad304_05146 pLX_304 0% 85.8% 87.3% V5 (many diffs) n/a
3 TRCN0000480689 AACTGACACCCCATTACTACCTTT pLX_317 20.5% 85.8% 87.3% V5 (many diffs) n/a
Download CSV