Transcript: Mouse XM_006505182.2

PREDICTED: Mus musculus S-adenosylhomocysteine hydrolase-like 2 (Ahcyl2), transcript variant X5, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ahcyl2 (74340)
Length:
5005
CDS:
212..1741

Additional Resources:

NCBI RefSeq record:
XM_006505182.2
NBCI Gene record:
Ahcyl2 (74340)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000101546 GCCTTGATAGAACTTTACAAT pLKO.1 1541 CDS 100% 5.625 7.875 N Ahcyl2 n/a
2 TRCN0000101549 GAACATCAAACAAGCGGAGTT pLKO.1 472 CDS 100% 4.050 5.670 N Ahcyl2 n/a
3 TRCN0000101547 GCCTAACTACTACAGGTATTA pLKO.1 1720 CDS 100% 13.200 9.240 N Ahcyl2 n/a
4 TRCN0000101545 GCCTCATAATTGGATCTCTTT pLKO.1 3821 3UTR 100% 4.950 3.465 N Ahcyl2 n/a
5 TRCN0000050165 CCGTATGAAGAATAGCTGCAT pLKO.1 1306 CDS 100% 2.640 1.848 N AHCYL2 n/a
6 TRCN0000101548 GCTTTAAGGAAGAGAGCCCAA pLKO.1 542 CDS 100% 2.160 1.512 N Ahcyl2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505182.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02757 pDONR223 100% 75.9% 81% None (many diffs) n/a
2 ccsbBroad304_02757 pLX_304 0% 75.9% 81% V5 (many diffs) n/a
3 TRCN0000481020 AAAGACACGACGTGGTCGTCTCCA pLX_317 22% 75.9% 81% V5 (many diffs) n/a
Download CSV