Transcript: Mouse XM_006505345.3

PREDICTED: Mus musculus caldesmon 1 (Cald1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Cald1 (109624)
Length:
4751
CDS:
207..2510

Additional Resources:

NCBI RefSeq record:
XM_006505345.3
NBCI Gene record:
Cald1 (109624)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108681 GCCGCATTAACGAATGGCTAA pLKO.1 2356 CDS 100% 4.050 5.670 N Cald1 n/a
2 TRCN0000303055 GCCGCATTAACGAATGGCTAA pLKO_005 2356 CDS 100% 4.050 5.670 N Cald1 n/a
3 TRCN0000108683 CGTCCGCAATATCAAGAGCAT pLKO.1 2249 CDS 100% 2.640 2.112 N Cald1 n/a
4 TRCN0000305037 GGAAGAGAAGAGGAGGTTAAA pLKO_005 1922 CDS 100% 13.200 9.240 N Cald1 n/a
5 TRCN0000348969 AGGAGTTTGATCCGACCATAA pLKO_005 544 CDS 100% 10.800 7.560 N Cald1 n/a
6 TRCN0000108682 GCAGCAGTAGTCTCCAAGATT pLKO.1 2130 CDS 100% 5.625 3.938 N Cald1 n/a
7 TRCN0000303124 GCAGCAGTAGTCTCCAAGATT pLKO_005 2130 CDS 100% 5.625 3.938 N Cald1 n/a
8 TRCN0000108684 GAAAGGATTTACAGAAGTGAA pLKO.1 1580 CDS 100% 4.950 3.465 N Cald1 n/a
9 TRCN0000108680 GCCTGTTTCTAAAGAAACCAT pLKO.1 2691 3UTR 100% 0.300 0.210 N Cald1 n/a
10 TRCN0000303123 GCCTGTTTCTAAAGAAACCAT pLKO_005 2691 3UTR 100% 0.300 0.210 N Cald1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505345.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00206 pDONR223 100% 58% 59.1% None (many diffs) n/a
2 ccsbBroad304_00206 pLX_304 0% 58% 59.1% V5 (many diffs) n/a
3 TRCN0000469974 CCGTTCGTCACCGTGCTACGTCCA pLX_317 29% 58% 59.1% V5 (many diffs) n/a
Download CSV