Transcript: Mouse XM_006505459.2

PREDICTED: Mus musculus cyclin D2 (Ccnd2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ccnd2 (12444)
Length:
6266
CDS:
224..1093

Additional Resources:

NCBI RefSeq record:
XM_006505459.2
NBCI Gene record:
Ccnd2 (12444)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000362653 TGTACACTCGAACCGTTATTA pLKO_005 1339 3UTR 100% 15.000 21.000 N Ccnd2 n/a
2 TRCN0000054767 GAAGGACATCCAACCGTACAT pLKO.1 364 CDS 100% 4.950 6.930 N Ccnd2 n/a
3 TRCN0000054766 CATTGAGCACATCCTTCGCAA pLKO.1 697 CDS 100% 2.640 3.696 N Ccnd2 n/a
4 TRCN0000362585 CTGCAACATGGGAACGAATTA pLKO_005 1430 3UTR 100% 13.200 10.560 N Ccnd2 n/a
5 TRCN0000054763 CCCGCAGTGTTCCTATTTCAA pLKO.1 334 CDS 100% 5.625 4.500 N Ccnd2 n/a
6 TRCN0000054765 CCGACTCCTAAGACCCATCTT pLKO.1 494 CDS 100% 4.950 3.960 N Ccnd2 n/a
7 TRCN0000054764 CGACTTCAAGTTTGCCATGTA pLKO.1 790 CDS 100% 4.950 3.960 N Ccnd2 n/a
8 TRCN0000362652 TTCCGTCAAGAGCAGCATAAC pLKO_005 1001 CDS 100% 10.800 7.560 N Ccnd2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505459.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05948 pDONR223 100% 88.7% 91.7% None (many diffs) n/a
2 ccsbBroad304_05948 pLX_304 0% 88.7% 91.7% V5 (many diffs) n/a
3 TRCN0000467811 CAGAGTGTGCTTTTGCATGCGCGC pLX_317 44% 88.7% 91.7% V5 (many diffs) n/a
Download CSV