Transcript: Mouse XM_006505510.2

PREDICTED: Mus musculus SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing DEAD/H box 1 (Smarcad1), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Smarcad1 (13990)
Length:
4489
CDS:
188..3253

Additional Resources:

NCBI RefSeq record:
XM_006505510.2
NBCI Gene record:
Smarcad1 (13990)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000095788 GAGGGTAATAAAGGGCCTCAT pLKO.1 1796 CDS 100% 4.050 3.240 N Smarcad1 n/a
2 TRCN0000095787 CCTCCCTTCTAAACCAAAGTT pLKO.1 1635 CDS 100% 5.625 3.938 N Smarcad1 n/a
3 TRCN0000095786 CCAGTATTACACACCTGAGAA pLKO.1 2539 CDS 100% 4.950 3.465 N Smarcad1 n/a
4 TRCN0000095785 CCACCATAGATAACTGGTTAA pLKO.1 1836 CDS 100% 10.800 6.480 N Smarcad1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505510.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_08660 pDONR223 100% 87.9% 91.9% None (many diffs) n/a
2 ccsbBroad304_08660 pLX_304 0% 87.9% 91.9% V5 (many diffs) n/a
3 TRCN0000475171 GCACATAATGCGGGATGCGATATG pLX_317 13.6% 87.9% 91.9% V5 (many diffs) n/a
Download CSV