Transcript: Mouse XM_006505519.3

PREDICTED: Mus musculus insulin-like growth factor 2 mRNA binding protein 3 (Igf2bp3), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Igf2bp3 (140488)
Length:
3974
CDS:
900..1850

Additional Resources:

NCBI RefSeq record:
XM_006505519.3
NBCI Gene record:
Igf2bp3 (140488)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000438228 TTTGCGGGAGCTTCGATTAAG pLKO_005 1410 CDS 100% 13.200 18.480 N Igf2bp3 n/a
2 TRCN0000096870 CGCGGAGAAGTCCATTACTAT pLKO.1 827 5UTR 100% 5.625 7.875 N Igf2bp3 n/a
3 TRCN0000096869 CCCTCTATAATGCCAGAAATT pLKO.1 2153 3UTR 100% 13.200 9.240 N Igf2bp3 n/a
4 TRCN0000444380 CTCAGTCAAGGCGGAAGTAAA pLKO_005 1831 CDS 100% 13.200 9.240 N Igf2bp3 n/a
5 TRCN0000437882 ACAATCCGGAACGCACCATTA pLKO_005 1072 CDS 100% 10.800 7.560 N Igf2bp3 n/a
6 TRCN0000096872 CCTACCCACAATTTGAGCAAT pLKO.1 1297 CDS 100% 4.950 3.465 N Igf2bp3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505519.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07663 pDONR223 100% 50.7% 53.8% None (many diffs) n/a
2 ccsbBroad304_07663 pLX_304 0% 50.7% 53.8% V5 (many diffs) n/a
3 TRCN0000492210 CGTCCGTTCGGGGGCACGCAGCCG pLX_317 25.2% 50.7% 53.8% V5 (many diffs) n/a
Download CSV