Transcript: Mouse XM_006505882.1

PREDICTED: Mus musculus transcription factor 7 like 1 (T cell specific, HMG box) (Tcf7l1), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Tcf7l1 (21415)
Length:
2950
CDS:
588..1961

Additional Resources:

NCBI RefSeq record:
XM_006505882.1
NBCI Gene record:
Tcf7l1 (21415)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006505882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000452579 GCCTTACCACTGTAGATATAA pLKO_005 2105 3UTR 100% 15.000 21.000 N Tcf7l1 n/a
2 TRCN0000095454 CGGGACTCCAAGTAGTAATGA pLKO.1 1990 3UTR 100% 5.625 7.875 N Tcf7l1 n/a
3 TRCN0000095457 GAAGGAAAGTGCAGCCATTAA pLKO.1 1304 CDS 100% 13.200 9.240 N Tcf7l1 n/a
4 TRCN0000441798 GGAAGCATTATTGGTCAATAT pLKO_005 2040 3UTR 100% 13.200 9.240 N Tcf7l1 n/a
5 TRCN0000021707 TGAAGGAAAGTGCAGCCATTA pLKO.1 1303 CDS 100% 10.800 7.560 N TCF7L1 n/a
6 TRCN0000095458 AGACACAGTCTCAGCAGCAAA pLKO.1 1492 CDS 100% 4.950 2.970 N Tcf7l1 n/a
7 TRCN0000121617 GAAGAAGAAGAAGAGGAAGAA pLKO.1 1454 CDS 100% 4.950 2.475 Y ARL6IP4 n/a
8 TRCN0000076558 GCCAGCCTAAGCTACAAGATA pLKO.1 106 5UTR 100% 5.625 2.813 Y Gpx5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006505882.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12735 pDONR223 100% 66.2% 71% None (many diffs) n/a
2 ccsbBroad304_12735 pLX_304 0% 66.2% 71% V5 (many diffs) n/a
3 TRCN0000476823 GGTCTGTTTCACTGTGTGTTTTTA pLX_317 12.3% 66.2% 71% V5 (many diffs) n/a
Download CSV