Transcript: Mouse XM_006506007.4

PREDICTED: Mus musculus glucoside xylosyltransferase 2 (Gxylt2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-08-08
Taxon:
Mus musculus (mouse)
Gene:
Gxylt2 (232313)
Length:
7563
CDS:
173..1375

Additional Resources:

NCBI RefSeq record:
XM_006506007.4
NBCI Gene record:
Gxylt2 (232313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506007.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000177616 CATAAGAAATACCCAGTTCAA pLKO.1 874 CDS 100% 4.950 3.960 N Gxylt2 n/a
2 TRCN0000217375 GAAGCTTCTGAGGCAGTTTAA pLKO.1 721 CDS 100% 13.200 9.240 N Gxylt2 n/a
3 TRCN0000198771 CCCAGAGTGTCTCTATGTGTT pLKO.1 1015 CDS 100% 4.950 3.465 N Gxylt2 n/a
4 TRCN0000198136 CTCATGAACTTGACTCGCATA pLKO.1 857 CDS 100% 4.050 2.835 N Gxylt2 n/a
5 TRCN0000181487 CCTGACCATTGCATGTATGGA pLKO.1 1058 CDS 100% 3.000 2.100 N Gxylt2 n/a
6 TRCN0000176712 CAAGCAAATTGAGAAGACGAT pLKO.1 1297 CDS 100% 2.640 1.848 N Gxylt2 n/a
7 TRCN0000181807 GCTGCCTGGATATTTGTGTGT pLKO.1 1410 3UTR 100% 2.640 1.848 N Gxylt2 n/a
8 TRCN0000106535 GCCTGGTCTACAAAGTGAGTT pLKO.1 6134 3UTR 100% 4.950 2.475 Y Gad2 n/a
9 TRCN0000054408 ACGCCTTTAATCCCAGCACTT pLKO.1 3227 3UTR 100% 4.050 2.025 Y Mtif2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506007.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13736 pDONR223 100% 53.3% 57.4% None (many diffs) n/a
2 ccsbBroad304_13736 pLX_304 0% 53.3% 57.4% V5 (many diffs) n/a
3 TRCN0000477641 ATAGGCTGTGTCAGCTCATTACTT pLX_317 45.2% 53.3% 57.4% V5 (many diffs) n/a
Download CSV