Transcript: Mouse XM_006506150.3

PREDICTED: Mus musculus ATP-binding cassette, sub-family G (WHITE), member 2 (Abcg2), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Abcg2 (26357)
Length:
2271
CDS:
237..2210

Additional Resources:

NCBI RefSeq record:
XM_006506150.3
NBCI Gene record:
Abcg2 (26357)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110806 CCCTGGCTTGTATGATTATTA pLKO.1 2137 CDS 100% 15.000 10.500 N Abcg2 n/a
2 TRCN0000325470 CCCTGGCTTGTATGATTATTA pLKO_005 2137 CDS 100% 15.000 10.500 N Abcg2 n/a
3 TRCN0000110805 GCCTCGGTATTCCATCTTTAA pLKO.1 965 CDS 100% 13.200 9.240 N Abcg2 n/a
4 TRCN0000325471 GCCTCGGTATTCCATCTTTAA pLKO_005 965 CDS 100% 13.200 9.240 N Abcg2 n/a
5 TRCN0000110808 GCCAGTCTATGTTACCTCTTT pLKO.1 1334 CDS 100% 4.950 3.465 N Abcg2 n/a
6 TRCN0000325480 GCCAGTCTATGTTACCTCTTT pLKO_005 1334 CDS 100% 4.950 3.465 N Abcg2 n/a
7 TRCN0000110809 TCAGGTTATGTGGTTCAAGAT pLKO.1 594 CDS 100% 4.950 3.465 N Abcg2 n/a
8 TRCN0000325502 TCAGGTTATGTGGTTCAAGAT pLKO_005 594 CDS 100% 4.950 3.465 N Abcg2 n/a
9 TRCN0000110807 CCAAAGGGATTATCTGGAGAT pLKO.1 528 CDS 100% 4.050 2.835 N Abcg2 n/a
10 TRCN0000325468 CCAAAGGGATTATCTGGAGAT pLKO_005 528 CDS 100% 4.050 2.835 N Abcg2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506150.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.