Transcript: Mouse XM_006506414.3

PREDICTED: Mus musculus gamma-glutamyl carboxylase (Ggcx), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ggcx (56316)
Length:
2611
CDS:
169..2058

Additional Resources:

NCBI RefSeq record:
XM_006506414.3
NBCI Gene record:
Ggcx (56316)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000119649 CGACCATTTGAACCAGTTGAT pLKO.1 1960 CDS 100% 4.950 6.930 N Ggcx n/a
2 TRCN0000323666 CGACCATTTGAACCAGTTGAT pLKO_005 1960 CDS 100% 4.950 6.930 N Ggcx n/a
3 TRCN0000119647 GCAGCCTGTTATAGGCTTATT pLKO.1 2091 3UTR 100% 1.320 1.056 N Ggcx n/a
4 TRCN0000323662 GCAGCCTGTTATAGGCTTATT pLKO_005 2091 3UTR 100% 1.320 1.056 N Ggcx n/a
5 TRCN0000119651 GCAGCCACTCTTGATGGATTT pLKO.1 1290 CDS 100% 10.800 7.560 N Ggcx n/a
6 TRCN0000323597 GCAGCCACTCTTGATGGATTT pLKO_005 1290 CDS 100% 10.800 7.560 N Ggcx n/a
7 TRCN0000119650 CCTGGCATATCTGCAAGAATT pLKO.1 1626 CDS 100% 0.000 0.000 N Ggcx n/a
8 TRCN0000323663 CCTGGCATATCTGCAAGAATT pLKO_005 1626 CDS 100% 0.000 0.000 N Ggcx n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506414.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00632 pDONR223 100% 73% 75.7% None (many diffs) n/a
2 ccsbBroad304_00632 pLX_304 0% 73% 75.7% V5 (many diffs) n/a
Download CSV