Transcript: Mouse XM_006506528.3

PREDICTED: Mus musculus neuron-derived neurotrophic factor (Ndnf), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ndnf (68169)
Length:
14859
CDS:
5275..6981

Additional Resources:

NCBI RefSeq record:
XM_006506528.3
NBCI Gene record:
Ndnf (68169)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006506528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000217892 GATACACCTAGAAGGTATTTC pLKO.1 5449 CDS 100% 13.200 18.480 N Ndnf n/a
2 TRCN0000430947 CCATACCCTGAATTACCATAT pLKO_005 5788 CDS 100% 10.800 15.120 N Ndnf n/a
3 TRCN0000193603 GCTTTATTTAAGCAGCTTCAA pLKO.1 8661 3UTR 100% 4.950 6.930 N Ndnf n/a
4 TRCN0000173539 GATGTTTACGTCGTAGGACAT pLKO.1 6904 CDS 100% 4.050 5.670 N Ndnf n/a
5 TRCN0000426650 AGATACACCTAGAAGGTATTT pLKO_005 5448 CDS 100% 13.200 10.560 N Ndnf n/a
6 TRCN0000174542 CCAATACTACTTTGATGTCTT pLKO.1 6198 CDS 100% 4.950 3.960 N Ndnf n/a
7 TRCN0000216068 CATCAACAAGGAGCACAATTT pLKO.1 5916 CDS 100% 13.200 9.240 N Ndnf n/a
8 TRCN0000426065 ACACTCTGTGAAGTATCAAAG pLKO_005 6930 CDS 100% 10.800 7.560 N Ndnf n/a
9 TRCN0000173650 CCCGAAGACACAAGAATCAAA pLKO.1 6616 CDS 100% 5.625 3.938 N Ndnf n/a
10 TRCN0000174766 GCACACATTCACAAATGCAAA pLKO.1 7293 3UTR 100% 4.950 3.465 N Ndnf n/a
11 TRCN0000173302 GCACAGAACTATTCTCCTACA pLKO.1 5639 CDS 100% 4.050 2.835 N Ndnf n/a
12 TRCN0000166364 CACACACACACACACACACAA pLKO.1 2308 5UTR 100% 4.950 2.475 Y KAAG1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006506528.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12576 pDONR223 100% 49.8% 51.2% None (many diffs) n/a
2 ccsbBroad304_12576 pLX_304 0% 49.8% 51.2% V5 (many diffs) n/a
3 TRCN0000469126 AAAAAACACTCAGTGTGAAACCGC pLX_317 41.2% 49.8% 51.2% V5 (many diffs) n/a
Download CSV