Transcript: Mouse XM_006507070.3

PREDICTED: Mus musculus fatty acyl CoA reductase 2 (Far2), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Far2 (330450)
Length:
3516
CDS:
328..1875

Additional Resources:

NCBI RefSeq record:
XM_006507070.3
NBCI Gene record:
Far2 (330450)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246470 CATAGGCCTAAATCAACATTA pLKO_005 1210 CDS 100% 13.200 18.480 N Far2 n/a
2 TRCN0000216792 GGGTTGGGTTGATAATCTAAA pLKO.1 1050 CDS 100% 13.200 18.480 N Far2 n/a
3 TRCN0000246469 TTCCCGGGTTGGGTTGATAAT pLKO_005 1045 CDS 100% 13.200 18.480 N Far2 n/a
4 TRCN0000217658 GCAATTTCACCACCCATTATT pLKO.1 1361 CDS 100% 15.000 12.000 N Far2 n/a
5 TRCN0000246472 GCAATTTCACCACCCATTATT pLKO_005 1361 CDS 100% 15.000 12.000 N Far2 n/a
6 TRCN0000217061 CAATCCCTGTAACTGGTATAA pLKO.1 1257 CDS 100% 13.200 9.240 N Far2 n/a
7 TRCN0000246473 CAATCCCTGTAACTGGTATAA pLKO_005 1257 CDS 100% 13.200 9.240 N Far2 n/a
8 TRCN0000216334 GGTTAAGAAGTATCTACTAAA pLKO.1 1647 CDS 100% 13.200 9.240 N Far2 n/a
9 TRCN0000190308 CGGAACGTCTGGTTCTTCATT pLKO.1 1795 CDS 100% 5.625 3.938 N Far2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507070.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03636 pDONR223 100% 84.1% 87.9% None (many diffs) n/a
2 ccsbBroad304_03636 pLX_304 0% 84.1% 87.9% V5 (many diffs) n/a
3 TRCN0000480027 TGGCAGCCGGTCCTCCTTCGACCC pLX_317 25.6% 84.1% 87.9% V5 (many diffs) n/a
Download CSV