Transcript: Mouse XM_006507103.2

PREDICTED: Mus musculus PTPRF interacting protein, binding protein 1 (liprin beta 1) (Ppfibp1), transcript variant X11, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ppfibp1 (67533)
Length:
5321
CDS:
724..3696

Additional Resources:

NCBI RefSeq record:
XM_006507103.2
NBCI Gene record:
Ppfibp1 (67533)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006507103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000182026 CGGAATCATAGCAGGTTCTAA pLKO.1 774 CDS 100% 5.625 7.875 N Ppfibp1 n/a
2 TRCN0000197674 CGAGACATTGAAGTACAGAAA pLKO.1 1531 CDS 100% 4.950 3.960 N Ppfibp1 n/a
3 TRCN0000197523 CCTTTGCTAAACTCATCATTA pLKO.1 4530 3UTR 100% 13.200 9.240 N Ppfibp1 n/a
4 TRCN0000002957 CGGTTAGAGCAGATGGAAGAT pLKO.1 3532 CDS 100% 4.950 3.465 N PPFIBP1 n/a
5 TRCN0000181895 GCACTCATATACCCATCAGAA pLKO.1 4433 3UTR 100% 4.950 3.465 N Ppfibp1 n/a
6 TRCN0000181654 GTAGAAACTATGGCCCAGTTA pLKO.1 3199 CDS 100% 4.950 3.465 N Ppfibp1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006507103.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07246 pDONR223 100% 82.7% 86.2% None (many diffs) n/a
2 ccsbBroad304_07246 pLX_304 0% 82.7% 86.2% V5 (many diffs) n/a
3 TRCN0000480925 TGCATACCACCTTCAATACTCTAT pLX_317 13.7% 82.7% 86.2% V5 (many diffs) n/a
Download CSV